java.lang.IllegalStateException: problem in scala.concurrent internal callback

Scala JIRA | Bruno Bieth | 3 years ago
  1. 0

    [SI-8069] InternalCallbackExecutor does not handle failures properly - Scala

    scala-lang.org | 1 year ago
    java.lang.IllegalStateException: problem in scala.concurrent internal callback
  2. 0

    As reported in https://twitter.com/crichardson/status/391689178146418688 the following {code} scala.concurrent.Future{1} zip null {code} fails with : {code} java.lang.IllegalStateException: problem in scala.concurrent internal callback at scala.concurrent.Future$InternalCallbackExecutor$.reportFailure(Future.scala:589) at scala.concurrent.impl.CallbackRunnable.executeWithValue(Promise.scala:40) at scala.concurrent.impl.Promise$DefaultPromise.scala$concurrent$impl$Promise$DefaultPromise$$dispatchOrAddCallback(Promise.scala:280) at scala.concurrent.impl.Promise$DefaultPromise.onComplete(Promise.scala:270) at scala.concurrent.Future$class.zip(Future.scala:361) at scala.concurrent.impl.Promise$DefaultPromise.zip(Promise.scala:153) at org.backuity.photo.IndexerTest.ff(IndexerTest.scala:34) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:45) at org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15) at org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:42) at org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20) at org.junit.runners.ParentRunner.runLeaf(ParentRunner.java:263) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:68) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:47) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:231) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:60) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:229) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:50) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:222) at org.junit.runners.ParentRunner.run(ParentRunner.java:300) at org.junit.runner.JUnitCore.run(JUnitCore.java:157) at com.intellij.junit4.JUnit4IdeaTestRunner.startRunnerWithArgs(JUnit4IdeaTestRunner.java:74) at com.intellij.rt.execution.junit.JUnitStarter.prepareStreamsAndStart(JUnitStarter.java:202) at com.intellij.rt.execution.junit.JUnitStarter.main(JUnitStarter.java:65) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) at com.intellij.rt.execution.application.AppMain.main(AppMain.java:120) Caused by: java.lang.IllegalArgumentException: requirement failed at scala.Predef$.require(Predef.scala:221) at scala.concurrent.Future$InternalCallbackExecutor$Batch.run(Future.scala:628) at scala.concurrent.Future$InternalCallbackExecutor$.scala$concurrent$Future$InternalCallbackExecutor$$unbatchedExecute(Future.scala:691) at scala.concurrent.Future$InternalCallbackExecutor$Batch$$anonfun$run$1.processBatch$1(Future.scala:649) at scala.concurrent.Future$InternalCallbackExecutor$Batch$$anonfun$run$1.apply$mcV$sp(Future.scala:655) at scala.concurrent.Future$InternalCallbackExecutor$Batch$$anonfun$run$1.apply(Future.scala:632) at scala.concurrent.Future$InternalCallbackExecutor$Batch$$anonfun$run$1.apply(Future.scala:632) at scala.concurrent.BlockContext$.withBlockContext(BlockContext.scala:72) at scala.concurrent.Future$InternalCallbackExecutor$Batch.run(Future.scala:631) at scala.concurrent.Future$InternalCallbackExecutor$.scala$concurrent$Future$InternalCallbackExecutor$$unbatchedExecute(Future.scala:691) at scala.concurrent.Future$InternalCallbackExecutor$.execute(Future.scala:682) ... 32 more {code} I took a quick look at it and this code seems suspicious (from 2.10.3 Future l.642): {code} case t: Throwable => // if one task throws, move the // remaining tasks to another thread // so we can throw the exception // up to the invoking executor val remaining = _tasksLocal.get _tasksLocal set Nil unbatchedExecute(new Batch(remaining)) throw t {code} The new Batch, executed in the same thread, will see non null `_tasksLocal` and fail, swallowing exception `t`.

    Scala JIRA | 3 years ago | Bruno Bieth
    java.lang.IllegalStateException: problem in scala.concurrent internal callback
  3. 0

    IllegalStateException in akka.dispatch.BatchingExecutor$Batch.run

    GitHub | 2 years ago | maxcom
    java.lang.IllegalStateException: exception in sameThreadExecutionContext
  4. Speed up your debug routine!

    Automated exception search integrated into your IDE

  5. 0

    subscription timeouts sometimes fail on same thread execution context

    GitHub | 2 years ago | ktoso
    java.lang.IllegalStateException: exception in sameThreadExecutionContext
  6. 0

    Running ADAM BQSR

    Google Groups | 2 years ago | Jaeki Hong
    java.lang.IllegalArgumentException: Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 18770101, "oldPosition": null, "end": 18770205, "mapq": 0, "readName": "chr22-14468580", "sequence": "ACTGGATTTTTAATTTTTAAATTTATTTTTTAATTTTAATTGTTGTTATTTAGGAGGTCATGTTTAAGTTTTTTTTTTAGGAGGGGCGCAGCGGCTGGAC", "qual": "C!!FFFFD2EH2HJ>E#ACIICGJJJCDIJDIJDGG?E)DJ#GI!I(##DGHH?HG8###JCHII@C#HDCDD#ADECDD#ABDD7A#>A#;!D#D#C!!", "cigar": "96M1D7=", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": true, "properPair": false, "readMapped": true, "mateMapped": false, "firstOfPair": false, "secondOfPair": true, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "PU:Z:pu\tSM:Z:sm\tNM:i:12\tPL:Z:Illumina\tRG:Z:FASTQ\tPG:Z:SNAP\tLB:Z:lb", "recordGroupName": "FASTQ", "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": "lb", "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": "Illumina", "recordGroupPlatformUnit": "pu", "recordGroupSample": "sm", "mateAlignmentStart": 18770101, "mateAlignmentEnd": null, "mateContig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}})

    Not finding the right solution?
    Take a tour to get the most out of Samebug.

    Tired of useless tips?

    Automated exception search integrated into your IDE

    Root Cause Analysis

    1. java.lang.IllegalArgumentException

      requirement failed

      at scala.Predef$.require()
    2. Scala
      Promise$DefaultPromise.zip
      1. scala.Predef$.require(Predef.scala:221)
      2. scala.concurrent.Future$InternalCallbackExecutor$Batch.run(Future.scala:628)
      3. scala.concurrent.Future$InternalCallbackExecutor$.scala$concurrent$Future$InternalCallbackExecutor$$unbatchedExecute(Future.scala:691)
      4. scala.concurrent.Future$InternalCallbackExecutor$Batch$$anonfun$run$1.processBatch$1(Future.scala:649)
      5. scala.concurrent.Future$InternalCallbackExecutor$Batch$$anonfun$run$1.apply$mcV$sp(Future.scala:655)
      6. scala.concurrent.Future$InternalCallbackExecutor$Batch$$anonfun$run$1.apply(Future.scala:632)
      7. scala.concurrent.Future$InternalCallbackExecutor$Batch$$anonfun$run$1.apply(Future.scala:632)
      8. scala.concurrent.BlockContext$.withBlockContext(BlockContext.scala:72)
      9. scala.concurrent.Future$InternalCallbackExecutor$Batch.run(Future.scala:631)
      10. scala.concurrent.Future$InternalCallbackExecutor$.scala$concurrent$Future$InternalCallbackExecutor$$unbatchedExecute(Future.scala:691)
      11. scala.concurrent.Future$InternalCallbackExecutor$.execute(Future.scala:682)
      12. scala.concurrent.Future$InternalCallbackExecutor$.reportFailure(Future.scala:589)
      13. scala.concurrent.impl.CallbackRunnable.executeWithValue(Promise.scala:40)
      14. scala.concurrent.impl.Promise$DefaultPromise.scala$concurrent$impl$Promise$DefaultPromise$$dispatchOrAddCallback(Promise.scala:280)
      15. scala.concurrent.impl.Promise$DefaultPromise.onComplete(Promise.scala:270)
      16. scala.concurrent.Future$class.zip(Future.scala:361)
      17. scala.concurrent.impl.Promise$DefaultPromise.zip(Promise.scala:153)
      17 frames
    3. org.backuity.photo
      IndexerTest.ff
      1. org.backuity.photo.IndexerTest.ff(IndexerTest.scala:34)
      1 frame
    4. Java RT
      DelegatingMethodAccessorImpl.invoke
      1. sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
      2. sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
      3. sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
      3 frames
    5. JUnit
      JUnitCore.run
      1. org.junit.runners.model.FrameworkMethod$1.runReflectiveCall(FrameworkMethod.java:45)
      2. org.junit.internal.runners.model.ReflectiveCallable.run(ReflectiveCallable.java:15)
      3. org.junit.runners.model.FrameworkMethod.invokeExplosively(FrameworkMethod.java:42)
      4. org.junit.internal.runners.statements.InvokeMethod.evaluate(InvokeMethod.java:20)
      5. org.junit.runners.ParentRunner.runLeaf(ParentRunner.java:263)
      6. org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:68)
      7. org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:47)
      8. org.junit.runners.ParentRunner$3.run(ParentRunner.java:231)
      9. org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:60)
      10. org.junit.runners.ParentRunner.runChildren(ParentRunner.java:229)
      11. org.junit.runners.ParentRunner.access$000(ParentRunner.java:50)
      12. org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:222)
      13. org.junit.runners.ParentRunner.run(ParentRunner.java:300)
      14. org.junit.runner.JUnitCore.run(JUnitCore.java:157)
      14 frames
    6. IntelliJ junit4 module
      JUnit4IdeaTestRunner.startRunnerWithArgs
      1. com.intellij.junit4.JUnit4IdeaTestRunner.startRunnerWithArgs(JUnit4IdeaTestRunner.java:74)
      1 frame
    7. IDEA
      JUnitStarter.main
      1. com.intellij.rt.execution.junit.JUnitStarter.prepareStreamsAndStart(JUnitStarter.java:202)
      2. com.intellij.rt.execution.junit.JUnitStarter.main(JUnitStarter.java:65)
      2 frames
    8. Java RT
      NativeMethodAccessorImpl.invoke
      1. sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
      2. sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57)
      2 frames
    9. IDEA
      AppMain.main
      1. com.intellij.rt.execution.application.AppMain.main(AppMain.java:120)
      1 frame