htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Record 40060, Read name ERR001301.6170436, bin field of BAM record does not equal value computed based on alignment start and end, and length of sequence to which read is aligned

GitHub | jpdna | 4 months ago
  1. 0

    GitHub comment 1104#240925643

    GitHub | 4 months ago | jpdna
    htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Record 40060, Read name ERR001301.6170436, bin field of BAM record does not equal value computed based on alignment start and end, and length of sequence to which read is aligned
  2. 0

    CollectQualityYieldMetrics has problems on RNASeq BAM file from tophat(bowtie1)

    GitHub | 2 years ago | sicotte
    htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Record 78218867, Read name R0251321:126:H7NGRADXX:2:1101:1537:1996, Mapped mate should have mate reference name
  3. 0

    MAPQ should be 0

    GitHub | 2 years ago | apelin20
    htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Record 9505, Read name HWI-D00104:87:D1GYYACXX:5:1112:13918:71031, MAPQ should be 0 for unmapped read.
  4. Speed up your debug routine!

    Automated exception search integrated into your IDE

  5. 0

    GitHub comment 370#170059528

    GitHub | 11 months ago | timodonnell
    htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Record 80, Read name HSQ1004:134:C0D8DACXX:3:1302:16380:148845, Mate Alignment start should be 0 because reference name = *.
  6. 0

    GitHub comment 2#174760952

    GitHub | 10 months ago | Flope
    htsjdk.samtools.SAMFormatException: Error parsing text SAM file. Tag of type i should have signed decimal value; File /dev/stdin; Line 247729 Line: HISEQ:318:H25NKADXY:1:2210:5526:37163 675 chr1 11167510 60 107M13S = 11167604 220 AAAAAACGTGATGGGCACATCTGGGCCTCCAGTTACCAGAAAGGGCACCTAAGAAGGCAGAAGGAAAAGGAATATTTTAATATTTTGAGCTCCTTCAAAGGTTTACAAGGAAACCTGGAA<)?77<AA5?A***5A>1?===<0=ABA############################################################################################ NM:i:3 MD:Z:62A19A8T15 AS:i:92 XS:i:20 RG:Z:769P_AH25NKADXY_L001 BC:Z:AGGGGG OP:i:11167510 XI:i:None XO:Z:AAAAAACGTGATGGGCACATCTGGGCCTCCAGTTACCAGAAAGGGCACCTAAGAAGGCAGAAGGAAAAGGAATATTTTAATATTTTGAGCTCCTTCAAAGGTTTACAAGGAAACCTGGAA OC:Z:107M13S

    Not finding the right solution?
    Take a tour to get the most out of Samebug.

    Tired of useless tips?

    Automated exception search integrated into your IDE

    Root Cause Analysis

    1. htsjdk.samtools.SAMFormatException

      SAM validation error: ERROR: Record 40060, Read name ERR001301.6170436, bin field of BAM record does not equal value computed based on alignment start and end, and length of sequence to which read is aligned

      at htsjdk.samtools.SAMUtils.processValidationErrors()
    2. HTS JDK
      SamReader$AssertingIterator.next
      1. htsjdk.samtools.SAMUtils.processValidationErrors(SAMUtils.java:441)
      2. htsjdk.samtools.BAMFileReader$BAMFileIterator.advance(BAMFileReader.java:652)
      3. htsjdk.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:637)
      4. htsjdk.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:607)
      5. htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:545)
      6. htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:519)
      6 frames
    3. picard.sam
      SamToFastq.doWork
      1. picard.sam.SamToFastq.doWork(SamToFastq.java:174)
      1 frame
    4. picard.cmdline
      PicardCommandLine.main
      1. picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:209)
      2. picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:95)
      3. picard.cmdline.PicardCommandLine.main(PicardCommandLine.java:105)
      3 frames