java.lang.IllegalArgumentException: Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 18770101, "oldPosition": null, "end": 18770205, "mapq": 0, "readName": "chr22-14468580", "sequence": "ACTGGATTTTTAATTTTTAAATTTATTTTTTAATTTTAATTGTTGTTATTTAGGAGGTCATGTTTAAGTTTTTTTTTTAGGAGGGGCGCAGCGGCTGGAC", "qual": "C!!FFFFD2EH2HJ>E#ACIICGJJJCDIJDIJDGG?E)DJ#GI!I(##DGHH?HG8###JCHII@C#HDCDD#ADECDD#ABDD7A#>A#;!D#D#C!!", "cigar": "96M1D7=", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": true, "properPair": false, "readMapped": true, "mateMapped": false, "firstOfPair": false, "secondOfPair": true, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "PU:Z:pu\tSM:Z:sm\tNM:i:12\tPL:Z:Illumina\tRG:Z:FASTQ\tPG:Z:SNAP\tLB:Z:lb", "recordGroupName": "FASTQ", "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": "lb", "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": "Illumina", "recordGroupPlatformUnit": "pu", "recordGroupSample": "sm", "mateAlignmentStart": 18770101, "mateAlignmentEnd": null, "mateContig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}})

Searched on Google with the first line of a JAVA stack trace?

We can recommend more relevant solutions and speed up debugging when you paste your entire stack trace with the exception message. Try a sample exception.

Recommended solutions based on your search

Solutions on the web

via Google Groups by Jaeki Hong, 1 year ago
Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 18770101, "oldPosition": null
via Google Groups by Jaeki Hong, 10 months ago
Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr5", "contigLength": 180915260, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 100447646, "oldPosition": null
via GitHub by Jaeki
, 2 years ago
Error "requirement failed: sequence and qualityScores must be same length" while constructing DecadentRead from Read({"contig": {"contigName": "1", "contigLength": 249250621, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null
via Google Groups by Yu-Ting Chen, 2 years ago
Error "1" while constructing DecadentRead from Read({"contig": {"contigName": "17", "contigLength": 81195210, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 79324793, "end": 79324863, "mapq": 0, "readName
via GitHub by fnothaft
, 2 years ago
Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"contig": {"contigName": "1", "contigLength": 249250621, "contigMD5": "1b22b98cdeb4a9304cb5d48026a85128", "referenceURL": "http:\/\/www.broadinstitute.org\/ftp
via GitHub by jpdna
, 1 year ago
Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null
java.lang.IllegalArgumentException: Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 18770101, "oldPosition": null, "end": 18770205, "mapq": 0, "readName": "chr22-14468580", "sequence": "ACTGGATTTTTAATTTTTAAATTTATTTTTTAATTTTAATTGTTGTTATTTAGGAGGTCATGTTTAAGTTTTTTTTTTAGGAGGGGCGCAGCGGCTGGAC", "qual": "C!!FFFFD2EH2HJ>E#ACIICGJJJCDIJDIJDGG?E)DJ#GI!I(##DGHH?HG8###JCHII@C#HDCDD#ADECDD#ABDD7A#>A#;!D#D#C!!", "cigar": "96M1D7=", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": true, "properPair": false, "readMapped": true, "mateMapped": false, "firstOfPair": false, "secondOfPair": true, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "PU:Z:pu\tSM:Z:sm\tNM:i:12\tPL:Z:Illumina\tRG:Z:FASTQ\tPG:Z:SNAP\tLB:Z:lb", "recordGroupName": "FASTQ", "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": "lb", "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": "Illumina", "recordGroupPlatformUnit": "pu", "recordGroupSample": "sm", "mateAlignmentStart": 18770101, "mateAlignmentEnd": null, "mateContig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}})
at scala.Predef$.require(Predef.scala:221)
at org.bdgenomics.adam.rich.DecadentRead.(DecadentRead.scala:70)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:36)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:32)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:50)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:50)
at scala.collection.Iterator$$anon$11.next(Iterator.scala:328)
at scala.collection.Iterator$$anon$14.hasNext(Iterator.scala:389)
at scala.collection.Iterator$$anon$13.hasNext(Iterator.scala:371)
at scala.collection.Iterator$$anon$11.hasNext(Iterator.scala:327)
at scala.collection.Iterator$class.foreach(Iterator.scala:727)
at scala.collection.AbstractIterator.foreach(Iterator.scala:1157)
at scala.collection.TraversableOnce$class.foldLeft(TraversableOnce.scala:144)
at scala.collection.AbstractIterator.foldLeft(Iterator.scala:1157)
at scala.collection.TraversableOnce$class.aggregate(TraversableOnce.scala:201)
at org.apache.spark.rdd.RDD$$anonfun$22.apply(RDD.scala:901)
at org.apache.spark.rdd.RDD$$anonfun$22.apply(RDD.scala:901)
at org.apache.spark.SparkContext$$anonfun$29.apply(SparkContext.scala:1350)
at org.apache.spark.SparkContext$$anonfun$29.apply(SparkContext.scala:1350)
at org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:61)
at org.apache.spark.scheduler.Task.run(Task.scala:56)
at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
at java.lang.Thread.run(Thread.java:745)

Users with the same issue

10 times, 9 months ago
Once, 1 year ago
Samebug visitor profile picture
Unknown user
Once, 1 year ago
Samebug visitor profile picture
Unknown user
Once, 1 year ago
Samebug visitor profile picture
Unknown user
Once, 1 year ago
46 more bugmates

Know the solutions? Share your knowledge to help other developers to debug faster.