java.lang.IllegalArgumentException

There are no available Samebug tips for this exception. Do you have an idea how to solve this issue? A short tip would help users who saw this issue last week.

  • Running ADAM BQSR
    via by Jaeki Hong,
  • Compute Cost of Kmeans
    via Stack Overflow by gsamaras
    ,
    • java.lang.IllegalArgumentException: Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 18770101, "oldPosition": null, "end": 18770205, "mapq": 0, "readName": "chr22-14468580", "sequence": "ACTGGATTTTTAATTTTTAAATTTATTTTTTAATTTTAATTGTTGTTATTTAGGAGGTCATGTTTAAGTTTTTTTTTTAGGAGGGGCGCAGCGGCTGGAC", "qual": "C!!FFFFD2EH2HJ>E#ACIICGJJJCDIJDIJDGG?E)DJ#GI!I(##DGHH?HG8###JCHII@C#HDCDD#ADECDD#ABDD7A#>A#;!D#D#C!!", "cigar": "96M1D7=", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": true, "properPair": false, "readMapped": true, "mateMapped": false, "firstOfPair": false, "secondOfPair": true, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "PU:Z:pu\tSM:Z:sm\tNM:i:12\tPL:Z:Illumina\tRG:Z:FASTQ\tPG:Z:SNAP\tLB:Z:lb", "recordGroupName": "FASTQ", "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": "lb", "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": "Illumina", "recordGroupPlatformUnit": "pu", "recordGroupSample": "sm", "mateAlignmentStart": 18770101, "mateAlignmentEnd": null, "mateContig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}}) at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:40) at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:32) at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:50) at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:50) at scala.collection.Iterator$$anon$11.next(Iterator.scala:328) at scala.collection.Iterator$$anon$14.hasNext(Iterator.scala:389) at scala.collection.Iterator$$anon$13.hasNext(Iterator.scala:371) at scala.collection.Iterator$$anon$11.hasNext(Iterator.scala:327) at scala.collection.Iterator$class.foreach(Iterator.scala:727) at scala.collection.AbstractIterator.foreach(Iterator.scala:1157) at scala.collection.TraversableOnce$class.foldLeft(TraversableOnce.scala:144) at scala.collection.AbstractIterator.foldLeft(Iterator.scala:1157) at scala.collection.TraversableOnce$class.aggregate(TraversableOnce.scala:201) at scala.collection.AbstractIterator.aggregate(Iterator.scala:1157) at org.apache.spark.rdd.RDD$$anonfun$22.apply(RDD.scala:901) at org.apache.spark.rdd.RDD$$anonfun$22.apply(RDD.scala:901) at org.apache.spark.SparkContext$$anonfun$29.apply(SparkContext.scala:1350) at org.apache.spark.SparkContext$$anonfun$29.apply(SparkContext.scala:1350) at org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:61) at org.apache.spark.scheduler.Task.run(Task.scala:56) at org.apache.spark.executor.Executor$TaskRunner.run(Executor.scala:196) at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615) at java.lang.Thread.run(Thread.java:745) Caused by: java.lang.IllegalArgumentException: requirement failed at scala.Predef$.require(Predef.scala:221) at org.bdgenomics.adam.rich.DecadentRead.<init>(DecadentRead.scala:70) at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:36) ... 23 more

    Users with the same issue

    Handemelindo
    10 times, last one,
    tyson925
    1 times, last one,
    Unknown visitor1 times, last one,
    Unknown visitor1 times, last one,
    Unknown visitor1 times, last one,
    43 more bugmates