java.lang.IllegalArgumentException: Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 18770101, "oldPosition": null, "end": 18770205, "mapq": 0, "readName": "chr22-14468580", "sequence": "ACTGGATTTTTAATTTTTAAATTTATTTTTTAATTTTAATTGTTGTTATTTAGGAGGTCATGTTTAAGTTTTTTTTTTAGGAGGGGCGCAGCGGCTGGAC", "qual": "C!!FFFFD2EH2HJ>E#ACIICGJJJCDIJDIJDGG?E)DJ#GI!I(##DGHH?HG8###JCHII@C#HDCDD#ADECDD#ABDD7A#>A#;!D#D#C!!", "cigar": "96M1D7=", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": true, "properPair": false, "readMapped": true, "mateMapped": false, "firstOfPair": false, "secondOfPair": true, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "PU:Z:pu\tSM:Z:sm\tNM:i:12\tPL:Z:Illumina\tRG:Z:FASTQ\tPG:Z:SNAP\tLB:Z:lb", "recordGroupName": "FASTQ", "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": "lb", "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": "Illumina", "recordGroupPlatformUnit": "pu", "recordGroupSample": "sm", "mateAlignmentStart": 18770101, "mateAlignmentEnd": null, "mateContig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}})

Google Groups | Jaeki Hong | 2 years ago
Do you find the tips below useful? Click on the to mark them and say thanks to rp . Or join the community to write better ones.
  1. 0

    Running ADAM BQSR

    Google Groups | 2 years ago | Jaeki Hong
    java.lang.IllegalArgumentException: Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 18770101, "oldPosition": null, "end": 18770205, "mapq": 0, "readName": "chr22-14468580", "sequence": "ACTGGATTTTTAATTTTTAAATTTATTTTTTAATTTTAATTGTTGTTATTTAGGAGGTCATGTTTAAGTTTTTTTTTTAGGAGGGGCGCAGCGGCTGGAC", "qual": "C!!FFFFD2EH2HJ>E#ACIICGJJJCDIJDIJDGG?E)DJ#GI!I(##DGHH?HG8###JCHII@C#HDCDD#ADECDD#ABDD7A#>A#;!D#D#C!!", "cigar": "96M1D7=", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": true, "properPair": false, "readMapped": true, "mateMapped": false, "firstOfPair": false, "secondOfPair": true, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "PU:Z:pu\tSM:Z:sm\tNM:i:12\tPL:Z:Illumina\tRG:Z:FASTQ\tPG:Z:SNAP\tLB:Z:lb", "recordGroupName": "FASTQ", "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": "lb", "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": "Illumina", "recordGroupPlatformUnit": "pu", "recordGroupSample": "sm", "mateAlignmentStart": 18770101, "mateAlignmentEnd": null, "mateContig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}})
  2. 0

    How should I define EM algorithm in Avocado configuration?

    Google Groups | 2 years ago | Jaeki Hong
    java.lang.IllegalArgumentException: Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr5", "contigLength": 180915260, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 100447646, "oldPosition": null, "end": 100447749, "mapq": 0, "readName": "ERR032973_884612", "sequence": "GGACAGTTCTTTAGATGTCTATTAGATCCTCTGGTGCAGAGCTGAGTTCAATTCCTGGGTATCCTTGTTGACTTTCTGTCTCATTGATCTGTCTAATGTTC", "qual": "?C7=@=71>27=BBAA?;9<74A<;:@BC=CC@CCC?@@C?CCC@CCC@CCCC@C@CCCBCC@CCCBBB@:B@@@@CCCCACCCCCB@CCCCCCCCABABB", "cigar": "31M1D71=", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": true, "properPair": true, "readMapped": true, "mateMapped": true, "firstOfPair": true, "secondOfPair": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": true, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "PU:Z:pu\tSM:Z:sm\tNM:i:6\tPL:Z:Illumina\tRG:Z:FASTQ\tPG:Z:SNAP\tLB:Z:lb", "recordGroupName": "FASTQ", "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": "lb", "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": "Illumina", "recordGroupPlatformUnit": "pu", "recordGroupSample": "sm", "mateAlignmentStart": 100447416, "mateAlignmentEnd": null, "mateContig": {"contigName": "chr5", "contigLength": 180915260, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}})
  3. 0

    Requirement failed warning while running BQSR @DecadentRead

    GitHub | 2 years ago | Jaeki
    java.lang.IllegalArgumentException: Error "requirement failed: sequence and qualityScores must be same length" while constructing DecadentRead from Read({"contig": {"contigName": "1", "contigLength": 249250621, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 26472783, "oldPosition": null, "end": 26472858, "mapq": 60, "readName": "simread:1:26472783:false", "sequence": "GTATAAGAGCAGCCTTATTCCTATTTATAATCAGGGTGAAACACCTGTGCCAATGCCAAGACAGGGGTGCCAAGA", "qual": "*", "cigar": "75M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "firstOfPair": false, "secondOfPair": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": true, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "XS:i:0\tAS:i:75\tNM:i:0", "recordGroupName": null, "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": null, "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": null, "recordGroupPlatformUnit": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null})
  4. Speed up your debug routine!

    Automated exception search integrated into your IDE

  5. 0
    samebug tip
    Try to restart Play

  1. bandoca 3 times, last 1 week ago
  2. rp 2 times, last 1 week ago
  3. Handemelindo 3 times, last 2 weeks ago
  4. tyson925 16 times, last 4 weeks ago
  5. poroszd 1 times, last 1 month ago
4 more registered users
35 unregistered visitors
Not finding the right solution?
Take a tour to get the most out of Samebug.

Tired of useless tips?

Automated exception search integrated into your IDE

Root Cause Analysis

  1. java.lang.IllegalArgumentException

    requirement failed

    at scala.Predef$.require()
  2. Scala
    1. scala.Predef$.require(Predef.scala:221)
    1 frame
  3. org.bdgenomics.adam
    5 frames
  4. Scala
    1. scala.collection.Iterator$$anon$
    2. scala.collection.Iterator$$anon$14.hasNext(Iterator.scala:389)
    3. scala.collection.Iterator$$anon$13.hasNext(Iterator.scala:371)
    4. scala.collection.Iterator$$anon$11.hasNext(Iterator.scala:327)
    5. scala.collection.Iterator$class.foreach(Iterator.scala:727)
    6. scala.collection.AbstractIterator.foreach(Iterator.scala:1157)
    7. scala.collection.TraversableOnce$class.foldLeft(TraversableOnce.scala:144)
    8. scala.collection.AbstractIterator.foldLeft(Iterator.scala:1157)
    9. scala.collection.TraversableOnce$class.aggregate(TraversableOnce.scala:201)
    10. scala.collection.AbstractIterator.aggregate(Iterator.scala:1157)
    10 frames
  5. Spark
    1. org.apache.spark.rdd.RDD$$anonfun$22.apply(RDD.scala:901)
    2. org.apache.spark.rdd.RDD$$anonfun$22.apply(RDD.scala:901)
    3. org.apache.spark.SparkContext$$anonfun$29.apply(SparkContext.scala:1350)
    4. org.apache.spark.SparkContext$$anonfun$29.apply(SparkContext.scala:1350)
    5. org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:61)
    7. org.apache.spark.executor.Executor$
    7 frames
  6. Java RT
    1. java.util.concurrent.ThreadPoolExecutor.runWorker(
    2. java.util.concurrent.ThreadPoolExecutor$
    3 frames