java.lang.NullPointerException

GitHub | ndimiduk | 3 weeks ago
tip
Do you find the tips below useful? Click on the to mark them and say thanks to poroszd . Or join the community to write better ones.
  1. 0
    samebug tip
    You should use java.sql.Timestamp or Date to map BsonDateTime from mongodb.
  2. 0

    Requirement failed warning while running BQSR @DecadentRead

    GitHub | 2 years ago | Jaeki
    java.lang.IllegalArgumentException: Error "requirement failed: sequence and qualityScores must be same length" while constructing DecadentRead from Read({"contig": {"contigName": "1", "contigLength": 249250621, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 26472783, "oldPosition": null, "end": 26472858, "mapq": 60, "readName": "simread:1:26472783:false", "sequence": "GTATAAGAGCAGCCTTATTCCTATTTATAATCAGGGTGAAACACCTGTGCCAATGCCAAGACAGGGGTGCCAAGA", "qual": "*", "cigar": "75M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "firstOfPair": false, "secondOfPair": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": true, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "XS:i:0\tAS:i:75\tNM:i:0", "recordGroupName": null, "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": null, "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": null, "recordGroupPlatformUnit": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null})
  3. Speed up your debug routine!

    Automated exception search integrated into your IDE

  4. 0

    Running ADAM BQSR

    Google Groups | 2 years ago | Jaeki Hong
    org.apache.spark.SparkException: Job aborted due to stage failure: Task 27 in stage 2.0 failed 1 times, most recent failure: Lost task 27.0 in stage 2.0 (TID 63, localhost): java.lang.IllegalArgumentException: Error "requirement failed" while constructing DecadentRead from Read({"contig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}, "start": 18770101, "oldPosition": null, "end": 18770205, "mapq": 0, "readName": "chr22-14468580", "sequence": "ACTGGATTTTTAATTTTTAAATTTATTTTTTAATTTTAATTGTTGTTATTTAGGAGGTCATGTTTAAGTTTTTTTTTTAGGAGGGGCGCAGCGGCTGGAC", "qual": "C!!FFFFD2EH2HJ>E#ACIICGJJJCDIJDIJDGG?E)DJ#GI!I(##DGHH?HG8###JCHII@C#HDCDD#ADECDD#ABDD7A#>A#;!D#D#C!!", "cigar": "96M1D7=", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": true, "properPair": false, "readMapped": true, "mateMapped": false, "firstOfPair": false, "secondOfPair": true, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": true, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": null, "origQual": null, "attributes": "PU:Z:pu\tSM:Z:sm\tNM:i:12\tPL:Z:Illumina\tRG:Z:FASTQ\tPG:Z:SNAP\tLB:Z:lb", "recordGroupName": "FASTQ", "recordGroupSequencingCenter": null, "recordGroupDescription": null, "recordGroupRunDateEpoch": null, "recordGroupFlowOrder": null, "recordGroupKeySequence": null, "recordGroupLibrary": "lb", "recordGroupPredictedMedianInsertSize": null, "recordGroupPlatform": "Illumina", "recordGroupPlatformUnit": "pu", "recordGroupSample": "sm", "mateAlignmentStart": 18770101, "mateAlignmentEnd": null, "mateContig": {"contigName": "chr22", "contigLength": 51304566, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null}})

    Not finding the right solution?
    Take a tour to get the most out of Samebug.

    Tired of useless tips?

    Automated exception search integrated into your IDE

    Root Cause Analysis

    1. java.lang.NullPointerException

      No message provided

      at org.elasticsearch.hadoop.rest.ScrollQuery.hasNext()
    2. Elasticsearch Hadoop
      ScrollQuery.hasNext
      1. org.elasticsearch.hadoop.rest.ScrollQuery.hasNext(ScrollQuery.java:87)
      1 frame
    3. Elasticsearch Spark
      AbstractEsRDDIterator.hasNext
      1. org.elasticsearch.spark.rdd.AbstractEsRDDIterator.hasNext(AbstractEsRDDIterator.scala:43)
      1 frame
    4. Scala
      AbstractIterator.aggregate
      1. scala.collection.Iterator$$anon$11.hasNext(Iterator.scala:327)
      2. scala.collection.Iterator$$anon$11.hasNext(Iterator.scala:327)
      3. scala.collection.Iterator$$anon$11.hasNext(Iterator.scala:327)
      4. scala.collection.Iterator$$anon$11.hasNext(Iterator.scala:327)
      5. scala.collection.Iterator$$anon$11.hasNext(Iterator.scala:327)
      6. scala.collection.Iterator$class.foreach(Iterator.scala:727)
      7. scala.collection.AbstractIterator.foreach(Iterator.scala:1157)
      8. scala.collection.TraversableOnce$class.foldLeft(TraversableOnce.scala:144)
      9. scala.collection.AbstractIterator.foldLeft(Iterator.scala:1157)
      10. scala.collection.TraversableOnce$class.aggregate(TraversableOnce.scala:201)
      11. scala.collection.AbstractIterator.aggregate(Iterator.scala:1157)
      11 frames
    5. Spark
      Executor$TaskRunner.run
      1. org.apache.spark.rdd.RDD$$anonfun$treeAggregate$1$$anonfun$23.apply(RDD.scala:1135)
      2. org.apache.spark.rdd.RDD$$anonfun$treeAggregate$1$$anonfun$23.apply(RDD.scala:1135)
      3. org.apache.spark.rdd.RDD$$anonfun$treeAggregate$1$$anonfun$24.apply(RDD.scala:1136)
      4. org.apache.spark.rdd.RDD$$anonfun$treeAggregate$1$$anonfun$24.apply(RDD.scala:1136)
      5. org.apache.spark.rdd.RDD$$anonfun$mapPartitions$1$$anonfun$apply$20.apply(RDD.scala:710)
      6. org.apache.spark.rdd.RDD$$anonfun$mapPartitions$1$$anonfun$apply$20.apply(RDD.scala:710)
      7. org.apache.spark.rdd.MapPartitionsRDD.compute(MapPartitionsRDD.scala:38)
      8. org.apache.spark.rdd.RDD.computeOrReadCheckpoint(RDD.scala:306)
      9. org.apache.spark.rdd.RDD.iterator(RDD.scala:270)
      10. org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:66)
      11. org.apache.spark.scheduler.Task.run(Task.scala:89)
      12. org.apache.spark.executor.Executor$TaskRunner.run(Executor.scala:227)
      12 frames
    6. Java RT
      Thread.run
      1. java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1142)
      2. java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:617)
      3. java.lang.Thread.run(Thread.java:745)
      3 frames